rabbit polyclonal antibody against piezo1 Search Results


94
Alomone Labs rabbit polyclonal abs against piezo1
Protein expression levels of Cav1.2, <t>Piezo1,</t> CaM, and Src in human LAA tissues. (A) Representative western blots and densitometric analysis of Cav1.2 and Piezo1 proteins in LA tissues of AF patients and those with SR. (B) Representative western blots and densitometric analysis of CaM and Src protein in LA tissues of AF patients and those with SR. GAPDH was the internal control. ** p < 0.01. Values are presented as the mean ± standard error of the mean (SEM).
Rabbit Polyclonal Abs Against Piezo1, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal abs against piezo1/product/Alomone Labs
Average 94 stars, based on 1 article reviews
rabbit polyclonal abs against piezo1 - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

96
Proteintech rabbit anti piezo1
Protein expression levels of Cav1.2, <t>Piezo1,</t> CaM, and Src in human LAA tissues. (A) Representative western blots and densitometric analysis of Cav1.2 and Piezo1 proteins in LA tissues of AF patients and those with SR. (B) Representative western blots and densitometric analysis of CaM and Src protein in LA tissues of AF patients and those with SR. GAPDH was the internal control. ** p < 0.01. Values are presented as the mean ± standard error of the mean (SEM).
Rabbit Anti Piezo1, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti piezo1/product/Proteintech
Average 96 stars, based on 1 article reviews
rabbit anti piezo1 - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

86
Cell Signaling Technology Inc primary antibodies
Protein expression levels of Cav1.2, <t>Piezo1,</t> CaM, and Src in human LAA tissues. (A) Representative western blots and densitometric analysis of Cav1.2 and Piezo1 proteins in LA tissues of AF patients and those with SR. (B) Representative western blots and densitometric analysis of CaM and Src protein in LA tissues of AF patients and those with SR. GAPDH was the internal control. ** p < 0.01. Values are presented as the mean ± standard error of the mean (SEM).
Primary Antibodies, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primary antibodies/product/Cell Signaling Technology Inc
Average 86 stars, based on 1 article reviews
primary antibodies - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

94
Novus Biologicals rabbit anti piezo1
Protein expression levels of Cav1.2, <t>Piezo1,</t> CaM, and Src in human LAA tissues. (A) Representative western blots and densitometric analysis of Cav1.2 and Piezo1 proteins in LA tissues of AF patients and those with SR. (B) Representative western blots and densitometric analysis of CaM and Src protein in LA tissues of AF patients and those with SR. GAPDH was the internal control. ** p < 0.01. Values are presented as the mean ± standard error of the mean (SEM).
Rabbit Anti Piezo1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti piezo1/product/Novus Biologicals
Average 94 stars, based on 1 article reviews
rabbit anti piezo1 - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

90
GenScript corporation anti-piezo1 rabbit polyclonal antibody
Protein expression levels of Cav1.2, <t>Piezo1,</t> CaM, and Src in human LAA tissues. (A) Representative western blots and densitometric analysis of Cav1.2 and Piezo1 proteins in LA tissues of AF patients and those with SR. (B) Representative western blots and densitometric analysis of CaM and Src protein in LA tissues of AF patients and those with SR. GAPDH was the internal control. ** p < 0.01. Values are presented as the mean ± standard error of the mean (SEM).
Anti Piezo1 Rabbit Polyclonal Antibody, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-piezo1 rabbit polyclonal antibody/product/GenScript corporation
Average 90 stars, based on 1 article reviews
anti-piezo1 rabbit polyclonal antibody - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

95
Novus Biologicals piezo1
FIGURE 3 The addition of 10 nM GsMTx4 for 8 h alters the expression of Piezo channels. (A) Western blotting experiments of Piezo channels and quantified values (Mean ± SEM, *P<0.05, **P<0.01). (B) RT-qPCR experiments of Piezo channels (Mean ± SEM, *P<0.05). (C) Immunofluorescence analysis of <t>Piezo1</t> channels. Nuclei were stained with Hoechst dye.The histogram quantifies the fluorescence intensity (Mean ± SEM, ***P<0.001). (D) Immunofluorescence analysis of Piezo2 channels. Nuclei were stained with Hoechst dye.The histogram quantifies the fluorescence intensity (Mean ± SEM, *P<0.05).
Piezo1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/piezo1/product/Novus Biologicals
Average 95 stars, based on 1 article reviews
piezo1 - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

86
Fisher Scientific piezo1 rabbit polyclonal antibody
FIGURE 3 The addition of 10 nM GsMTx4 for 8 h alters the expression of Piezo channels. (A) Western blotting experiments of Piezo channels and quantified values (Mean ± SEM, *P<0.05, **P<0.01). (B) RT-qPCR experiments of Piezo channels (Mean ± SEM, *P<0.05). (C) Immunofluorescence analysis of <t>Piezo1</t> channels. Nuclei were stained with Hoechst dye.The histogram quantifies the fluorescence intensity (Mean ± SEM, ***P<0.001). (D) Immunofluorescence analysis of Piezo2 channels. Nuclei were stained with Hoechst dye.The histogram quantifies the fluorescence intensity (Mean ± SEM, *P<0.05).
Piezo1 Rabbit Polyclonal Antibody, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/piezo1 rabbit polyclonal antibody/product/Fisher Scientific
Average 86 stars, based on 1 article reviews
piezo1 rabbit polyclonal antibody - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

91
ProSci Incorporated rabbit polyclonal antibody against fam38b piezo2
FIGURE 3 The addition of 10 nM GsMTx4 for 8 h alters the expression of Piezo channels. (A) Western blotting experiments of Piezo channels and quantified values (Mean ± SEM, *P<0.05, **P<0.01). (B) RT-qPCR experiments of Piezo channels (Mean ± SEM, *P<0.05). (C) Immunofluorescence analysis of <t>Piezo1</t> channels. Nuclei were stained with Hoechst dye.The histogram quantifies the fluorescence intensity (Mean ± SEM, ***P<0.001). (D) Immunofluorescence analysis of Piezo2 channels. Nuclei were stained with Hoechst dye.The histogram quantifies the fluorescence intensity (Mean ± SEM, *P<0.05).
Rabbit Polyclonal Antibody Against Fam38b Piezo2, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal antibody against fam38b piezo2/product/ProSci Incorporated
Average 91 stars, based on 1 article reviews
rabbit polyclonal antibody against fam38b piezo2 - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

95
Novus Biologicals rabbit piezo1
Fig. 1. Role of <t>PIEZO1</t> and PIEZO2 in primary porcine chondrocytes during mechanical or pharmacologic activation. (A) Immunohistochemistry staining for PIEZO1 (red), PIEZO2 (yellow), and DAPI (blue). (Scale bar: 5 µm.) (B) mRNA levels of PIEZO1 (P1) and PIEZO2 (P2) normalized to ACTB expression level in nontargeting control (NTC) and P1-siRNA or P2-siRNA. (C) Protein levels of PIEZO1 (Left) and PIEZO2 (Right) in NTC and P1-siRNA or P2-siRNA chondrocytes. (D) AFM loading response of P1-siRNA cells compared to their respective NTCs showing representative cell signaling trend, normalized intracellular Ca2+ fluorescence intensity ΔFmax/F, the percentage of the responding cells, and deformation. (E) Confocal imaging results of Yoda1 stimulation of P1-siRNA cells compared to their respective NTCs showing representative cell signaling trend, normalized intracellular Ca2+ fluorescence intensity ΔFmax/F, and the percentage of responding cells. Similarly, results for P2-siRNA cells (F) AFM loading and (G) confocal imaging. Data presented as mean ± SEM. For B, n = 8 samples; for D and F, percentage of responders, n = 4 to 5 test batches, for applied deformation and Ca2+ response to AFM mechanical loading, n = 73 to 96 cells; For E and G, n = 9 to 21 tested wells; for group comparison B, D–G, t test, *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001.
Rabbit Piezo1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit piezo1/product/Novus Biologicals
Average 95 stars, based on 1 article reviews
rabbit piezo1 - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

90
Genosphere fam38a rabbit polyclonal antibodies
Fig. 1. Role of <t>PIEZO1</t> and PIEZO2 in primary porcine chondrocytes during mechanical or pharmacologic activation. (A) Immunohistochemistry staining for PIEZO1 (red), PIEZO2 (yellow), and DAPI (blue). (Scale bar: 5 µm.) (B) mRNA levels of PIEZO1 (P1) and PIEZO2 (P2) normalized to ACTB expression level in nontargeting control (NTC) and P1-siRNA or P2-siRNA. (C) Protein levels of PIEZO1 (Left) and PIEZO2 (Right) in NTC and P1-siRNA or P2-siRNA chondrocytes. (D) AFM loading response of P1-siRNA cells compared to their respective NTCs showing representative cell signaling trend, normalized intracellular Ca2+ fluorescence intensity ΔFmax/F, the percentage of the responding cells, and deformation. (E) Confocal imaging results of Yoda1 stimulation of P1-siRNA cells compared to their respective NTCs showing representative cell signaling trend, normalized intracellular Ca2+ fluorescence intensity ΔFmax/F, and the percentage of responding cells. Similarly, results for P2-siRNA cells (F) AFM loading and (G) confocal imaging. Data presented as mean ± SEM. For B, n = 8 samples; for D and F, percentage of responders, n = 4 to 5 test batches, for applied deformation and Ca2+ response to AFM mechanical loading, n = 73 to 96 cells; For E and G, n = 9 to 21 tested wells; for group comparison B, D–G, t test, *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001.
Fam38a Rabbit Polyclonal Antibodies, supplied by Genosphere, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fam38a rabbit polyclonal antibodies/product/Genosphere
Average 90 stars, based on 1 article reviews
fam38a rabbit polyclonal antibodies - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

94
Novus Biologicals mouse monoclonal anti piezo1 antibody
Instability of <t>Piezo1</t> loss-of-function mutants correlates with increased ubiquitination. (A) Piezo1 −/− HEK293T cells overexpressing wild-type (WT) or mutant Piezo1-GFP were treated with 10 μg/ml cycloheximide (CHX) for 0, 4 or 8 h before being collected for western blotting. (B) Summary data of panel (A) showing Piezo1 protein levels normalized to α-Actinin. (* p = 0.0320 and * p = 0.0133 for S217L at 4 and 8 h; * p = 0.0180 and * p = 0.0168 for G2029R at 4 and 8 h) (C) WT or mutant Piezo1-GFP expressed in Piezo1 −/− HEK293T cells were immunoprecipitated using an anti-GFP antibody and the eluted fraction and input cell lysate were probed for Piezo1 levels. An immunoblot of the immunoprecipitated protein using a mono- and poly-ubiquitin (Ub) antibody is also shown (M = marker). (D) Summary data of panel C showing the level of Piezo1 ubiquitination normalized to the level of immunoprecipitated Piezo1 protein ( n = 4 for all experiments). One way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis.
Mouse Monoclonal Anti Piezo1 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse monoclonal anti piezo1 antibody/product/Novus Biologicals
Average 94 stars, based on 1 article reviews
mouse monoclonal anti piezo1 antibody - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

90
ABclonal Biotechnology fam38a/piezo1 rabbit mab antibody

Fam38a/Piezo1 Rabbit Mab Antibody, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fam38a/piezo1 rabbit mab antibody/product/ABclonal Biotechnology
Average 90 stars, based on 1 article reviews
fam38a/piezo1 rabbit mab antibody - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Protein expression levels of Cav1.2, Piezo1, CaM, and Src in human LAA tissues. (A) Representative western blots and densitometric analysis of Cav1.2 and Piezo1 proteins in LA tissues of AF patients and those with SR. (B) Representative western blots and densitometric analysis of CaM and Src protein in LA tissues of AF patients and those with SR. GAPDH was the internal control. ** p < 0.01. Values are presented as the mean ± standard error of the mean (SEM).

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Protein expression levels of Cav1.2, Piezo1, CaM, and Src in human LAA tissues. (A) Representative western blots and densitometric analysis of Cav1.2 and Piezo1 proteins in LA tissues of AF patients and those with SR. (B) Representative western blots and densitometric analysis of CaM and Src protein in LA tissues of AF patients and those with SR. GAPDH was the internal control. ** p < 0.01. Values are presented as the mean ± standard error of the mean (SEM).

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Expressing, Western Blot

Effects of hypertension on the incidence of AF, I Ca,L , and Piezo1 expression in Wistar rats and SHRs with and without Val treatment. (A) Representative baseline surface ECG and intra-atrial electrocardiogram (IAEG); (B) The incidence AF in Wistar rats and SHRs treated with and without Val treatment ( n = 8). ** p < 0.01 vs. Wistar rat; ## p < < 0.01 vs. SHRs. (C) Typical surface ECG recordings of rats with AF that spontaneously reverted to SR and typical disorganized amplification of atrial waves (f wave). (D) Representative traces of AP in atrial myocytes from Wistar rats, SHRs, and SHR + Val groups and a histogram of APD in atrial myocytes from each group ( n = 12–15 myocytes from 3–4 rats). * p < 0.05 vs. Wistar rat; # p < 0.05 vs. SHRs. (E) Representative traces of I Ca,L (pulse protocol, inset), corresponding current-voltage relationship, mean data for voltage dependence activation, inactivation, and time course of recovery current for I Ca,L in atrial myocytes of each group ( n = 8–14 myocytes from 3–4 rats). (F) Representative examples of immunohistochemical analysis of LA tissues from Wistar rats and SHRs treated with and without Val using Ab against Piezo1. Scale bar, 20 μm. (G) Representative western blots and densitometric analysis of Cav1.2, Piezo1, CaM, and Src in LA tissues of Wistar rats and SHRs. GAPDH was the internal control. Values are presented as the mean ± SEM.

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Effects of hypertension on the incidence of AF, I Ca,L , and Piezo1 expression in Wistar rats and SHRs with and without Val treatment. (A) Representative baseline surface ECG and intra-atrial electrocardiogram (IAEG); (B) The incidence AF in Wistar rats and SHRs treated with and without Val treatment ( n = 8). ** p < 0.01 vs. Wistar rat; ## p < < 0.01 vs. SHRs. (C) Typical surface ECG recordings of rats with AF that spontaneously reverted to SR and typical disorganized amplification of atrial waves (f wave). (D) Representative traces of AP in atrial myocytes from Wistar rats, SHRs, and SHR + Val groups and a histogram of APD in atrial myocytes from each group ( n = 12–15 myocytes from 3–4 rats). * p < 0.05 vs. Wistar rat; # p < 0.05 vs. SHRs. (E) Representative traces of I Ca,L (pulse protocol, inset), corresponding current-voltage relationship, mean data for voltage dependence activation, inactivation, and time course of recovery current for I Ca,L in atrial myocytes of each group ( n = 8–14 myocytes from 3–4 rats). (F) Representative examples of immunohistochemical analysis of LA tissues from Wistar rats and SHRs treated with and without Val using Ab against Piezo1. Scale bar, 20 μm. (G) Representative western blots and densitometric analysis of Cav1.2, Piezo1, CaM, and Src in LA tissues of Wistar rats and SHRs. GAPDH was the internal control. Values are presented as the mean ± SEM.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Expressing, Amplification, Activation Assay, Immunohistochemical staining, Western Blot

Effect of HHP on the depression of I Ca,L in HL-1 cells. (A) Representative traces of AP in HL-1 cells under various hydrostatic pressures (0, 20, and 40 mmHg) for 24 h. APD 50 , APD 70 , and APD 90 of HL-1 cells were calculated ( n = 9, 10, and 7 at 0, 20, and 40 mmHg, respectively). * p < 0.05, ** p < 0.01 vs. 0 mmHg. (B) Representative traces (pulse protocol, inset), corresponding current-voltage relationship, mean data for voltage dependence activation, inactivation, and time course of recovery current for I Ca,L ( n = 8–18 at 0, 20, and 40 mmHg, respectively). * p < 0.05, ** p < 0.01 vs. 0 mmHg. (C) Representative western blots and densitometric analysis of Cav1.2, Piezo1, CaM, and Src in HL-1 cells under various hydrostatic pressure (0, 20, and 40 mmHg) for 24 h. GAPDH was used as an internal control. Values are presented as the mean ± SEM.

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Effect of HHP on the depression of I Ca,L in HL-1 cells. (A) Representative traces of AP in HL-1 cells under various hydrostatic pressures (0, 20, and 40 mmHg) for 24 h. APD 50 , APD 70 , and APD 90 of HL-1 cells were calculated ( n = 9, 10, and 7 at 0, 20, and 40 mmHg, respectively). * p < 0.05, ** p < 0.01 vs. 0 mmHg. (B) Representative traces (pulse protocol, inset), corresponding current-voltage relationship, mean data for voltage dependence activation, inactivation, and time course of recovery current for I Ca,L ( n = 8–18 at 0, 20, and 40 mmHg, respectively). * p < 0.05, ** p < 0.01 vs. 0 mmHg. (C) Representative western blots and densitometric analysis of Cav1.2, Piezo1, CaM, and Src in HL-1 cells under various hydrostatic pressure (0, 20, and 40 mmHg) for 24 h. GAPDH was used as an internal control. Values are presented as the mean ± SEM.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Activation Assay, Western Blot

The effects of Piezo1 on perceiving HHP and mediating the decrease of I Ca,L . (A,B) Representative Ca 2+ traces and Δ Ca i 2 + (ΔF/F) are shown. Ca 2+ entry was evoked by 10 μm Yoda1 in HL-1 cells stimulated by HHP in the presence or absence of the Piezo1 inhibitor GsmTx4 ( n = 50) or siRNA specifically knockdown Piezo1 ( n = 53–58). si-C, scrambled (control) siRNA; si-P, siRNA directed against Piezo1. (C) Representative traces of AP in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment (3.0 μM) and APD 50 , APD 70 , and APD 90 of HL-1 cells were calculated ( n = 9, 7, and 11 at 0, 40, and 40 mmHg + GsmTx4). * p < 0.05, ** p < 0.01 vs. 0 mmHg; # p < 0.05 vs. 40 mmHg. (D) Representative traces (pulse protocol, inset), corresponding current–voltage relationship, mean data for voltage dependence activation, inactivation, and time course of recovery current for I Ca,L in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment ( n = 9–15). ** p < 0.01 vs. 0 mmHg; ## p < 0.01 vs. 40 mmHg. (E) Representative blots and densitometry analysis of Cav1.2 in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment. (F) Representative blots and densitometry analysis of Cav1.2 in Yoda1 stimulation at different dosages (1, 3, and 10 μM) for 48 h. GAPDH was used as an internal control. Values are presented as the mean ± SEM.

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: The effects of Piezo1 on perceiving HHP and mediating the decrease of I Ca,L . (A,B) Representative Ca 2+ traces and Δ Ca i 2 + (ΔF/F) are shown. Ca 2+ entry was evoked by 10 μm Yoda1 in HL-1 cells stimulated by HHP in the presence or absence of the Piezo1 inhibitor GsmTx4 ( n = 50) or siRNA specifically knockdown Piezo1 ( n = 53–58). si-C, scrambled (control) siRNA; si-P, siRNA directed against Piezo1. (C) Representative traces of AP in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment (3.0 μM) and APD 50 , APD 70 , and APD 90 of HL-1 cells were calculated ( n = 9, 7, and 11 at 0, 40, and 40 mmHg + GsmTx4). * p < 0.05, ** p < 0.01 vs. 0 mmHg; # p < 0.05 vs. 40 mmHg. (D) Representative traces (pulse protocol, inset), corresponding current–voltage relationship, mean data for voltage dependence activation, inactivation, and time course of recovery current for I Ca,L in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment ( n = 9–15). ** p < 0.01 vs. 0 mmHg; ## p < 0.01 vs. 40 mmHg. (E) Representative blots and densitometry analysis of Cav1.2 in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment. (F) Representative blots and densitometry analysis of Cav1.2 in Yoda1 stimulation at different dosages (1, 3, and 10 μM) for 48 h. GAPDH was used as an internal control. Values are presented as the mean ± SEM.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Activation Assay

Effect of CaM/Src on the decrease of I Ca,L induced by HHP or Yoda1 stimulation. (A) Representative blots and densitometry analysis of CaM and Src in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment. (B) Representative blots and densitometry analysis of CaM and Src in Yoda1 stimulation at different dosages (1, 3, and 10 μM) for 48 h. (C) Representative blots and densitometry analysis of Src and p-Src ( n = 4) in HL-1 cells transfected with scrambled (control) siRNA or siRNA directed against Piezo1 for 48 h, then treated with Yoda1 at different dosages (0, 1, and 3 μM) for 15 min. (D) Representative traces of AP and histogram of APD in HL-1 cells ( n = 7–8). * p < 0.05 vs. 0 mmHg + DMSO. # p < 0.05 vs. 40 mmHg + DMSO. (E) Current–voltage relationship for I Ca,L ( n = 9–17) in HL-1 cells stimulated by 40 mmHg pressure treated with 15 μM PP1 or W7. * p < 0.05 vs. 0 mmHg + DMSO. # p < 0.05 vs. 40 mmHg + DMSO. (F) Representative blots and densitometry analysis of Cav1.2 and Src in HL-1 cells stimulated by 40 mmHg pressure treated with W7 under different concentrations (5, 10, 15, and 20 μM). (G) Representative blots and densitometry analysis of Cav1.2 in HL-1 cells stimulated by 40 mmHg pressure treated with PP1 (15 μM). (H) Current-voltage relationship for I Ca,L ( n = 8–10) in HL-1 cells stimulated by Yoda1(3 μM) treated with PP1. * p < 0.05, ** p < 0.01 vs. DMSO. # p < 0.05, ## p < 0.01 vs. Yoda1. (I) Representative blots and densitometry analysis of Cav1.2 in Yoda1(3μM) -stimulated HL-1 cells treated with PP1 (15 μM). GAPDH was used as an internal control. Values are presented as the mean ± SEM.

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Effect of CaM/Src on the decrease of I Ca,L induced by HHP or Yoda1 stimulation. (A) Representative blots and densitometry analysis of CaM and Src in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment. (B) Representative blots and densitometry analysis of CaM and Src in Yoda1 stimulation at different dosages (1, 3, and 10 μM) for 48 h. (C) Representative blots and densitometry analysis of Src and p-Src ( n = 4) in HL-1 cells transfected with scrambled (control) siRNA or siRNA directed against Piezo1 for 48 h, then treated with Yoda1 at different dosages (0, 1, and 3 μM) for 15 min. (D) Representative traces of AP and histogram of APD in HL-1 cells ( n = 7–8). * p < 0.05 vs. 0 mmHg + DMSO. # p < 0.05 vs. 40 mmHg + DMSO. (E) Current–voltage relationship for I Ca,L ( n = 9–17) in HL-1 cells stimulated by 40 mmHg pressure treated with 15 μM PP1 or W7. * p < 0.05 vs. 0 mmHg + DMSO. # p < 0.05 vs. 40 mmHg + DMSO. (F) Representative blots and densitometry analysis of Cav1.2 and Src in HL-1 cells stimulated by 40 mmHg pressure treated with W7 under different concentrations (5, 10, 15, and 20 μM). (G) Representative blots and densitometry analysis of Cav1.2 in HL-1 cells stimulated by 40 mmHg pressure treated with PP1 (15 μM). (H) Current-voltage relationship for I Ca,L ( n = 8–10) in HL-1 cells stimulated by Yoda1(3 μM) treated with PP1. * p < 0.05, ** p < 0.01 vs. DMSO. # p < 0.05, ## p < 0.01 vs. Yoda1. (I) Representative blots and densitometry analysis of Cav1.2 in Yoda1(3μM) -stimulated HL-1 cells treated with PP1 (15 μM). GAPDH was used as an internal control. Values are presented as the mean ± SEM.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Transfection

Schematic representation of the mechanism for the decrease of I Ca,L induced by HHP. Piezo1 activated by HHP depressed I Ca,L contributing to increased AF susceptibility through the CaM/Src/Pitx2 pathway.

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Schematic representation of the mechanism for the decrease of I Ca,L induced by HHP. Piezo1 activated by HHP depressed I Ca,L contributing to increased AF susceptibility through the CaM/Src/Pitx2 pathway.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques:

FIGURE 3 The addition of 10 nM GsMTx4 for 8 h alters the expression of Piezo channels. (A) Western blotting experiments of Piezo channels and quantified values (Mean ± SEM, *P<0.05, **P<0.01). (B) RT-qPCR experiments of Piezo channels (Mean ± SEM, *P<0.05). (C) Immunofluorescence analysis of Piezo1 channels. Nuclei were stained with Hoechst dye.The histogram quantifies the fluorescence intensity (Mean ± SEM, ***P<0.001). (D) Immunofluorescence analysis of Piezo2 channels. Nuclei were stained with Hoechst dye.The histogram quantifies the fluorescence intensity (Mean ± SEM, *P<0.05).

Journal: Frontiers in endocrinology

Article Title: Examination of the mechanism of Piezo ion channel in 5-HT synthesis in the enterochromaffin cell and its association with gut motility.

doi: 10.3389/fendo.2023.1193556

Figure Lengend Snippet: FIGURE 3 The addition of 10 nM GsMTx4 for 8 h alters the expression of Piezo channels. (A) Western blotting experiments of Piezo channels and quantified values (Mean ± SEM, *P<0.05, **P<0.01). (B) RT-qPCR experiments of Piezo channels (Mean ± SEM, *P<0.05). (C) Immunofluorescence analysis of Piezo1 channels. Nuclei were stained with Hoechst dye.The histogram quantifies the fluorescence intensity (Mean ± SEM, ***P<0.001). (D) Immunofluorescence analysis of Piezo2 channels. Nuclei were stained with Hoechst dye.The histogram quantifies the fluorescence intensity (Mean ± SEM, *P<0.05).

Article Snippet: Gene sequence ACTB-F GAGACCGCGTCCGCC ACTB-R ATCATCCATGGTGAGCTGGC TPH1-F CCCTTTGATCCCAAGATTAC TPH1-R CATTCATGGCACTGGTTATG PIEZO1-F ATCGCCATCATCTGGTTCCC PIEZO1-R TGGTGAACAGCGGCTCATAG PIEZO2-F TGGACACCATTGACGAGCAT PIEZO2-R CTTCAGTGTAGCAGCTGGAGAT PKCA-F GTCCACAAGAGGTGCCATGAA PKCA-R AAGGTGGGGCTTCCGTAAGT IP3R-F GCGGAGGGATCGACAAATGG IP3R-R TGGGACATAGCTTAAAGAGGCA MAPK-F TACACCAACCTCTCGTACATCG MAPK-R CATGTCTGAAGCGCAGTAAGATT AMPK-F TTGAAACCTGAAAATGTCCTGCT AMPK-R GGTGAGCCACAACTTGTTCTT frontiersin.org antibody: TPH1 (T0678, 1:200; Merck), Piezo1 (NBP1-78537, 1:200; Novus), Piezo2 (NBP1-78624, 1:200; Novus).

Techniques: Expressing, Western Blot, Quantitative RT-PCR, Staining

FIGURE 7 Diagram of the main content of this article (created with biorender.com). GsMTx4 can inhibit the increase of intracellular calcium induced by mechanical stimulation, leading to a decrease in the protein expression of Piezo1 and Piezo2, and an increase in the protein expression of TPH1. During this process, the phosphorylation level of p38 protein increases. At the same time, there is an increase in the secretion of 5-HT. However, there is no sufficient evidence supporting the association between the changes in Piezo1/2 and TPH1 proteins and p38 protein phosphorylation. Additionally, the mechanism underlying the increased 5-HT secretion also requires further experimental research.

Journal: Frontiers in endocrinology

Article Title: Examination of the mechanism of Piezo ion channel in 5-HT synthesis in the enterochromaffin cell and its association with gut motility.

doi: 10.3389/fendo.2023.1193556

Figure Lengend Snippet: FIGURE 7 Diagram of the main content of this article (created with biorender.com). GsMTx4 can inhibit the increase of intracellular calcium induced by mechanical stimulation, leading to a decrease in the protein expression of Piezo1 and Piezo2, and an increase in the protein expression of TPH1. During this process, the phosphorylation level of p38 protein increases. At the same time, there is an increase in the secretion of 5-HT. However, there is no sufficient evidence supporting the association between the changes in Piezo1/2 and TPH1 proteins and p38 protein phosphorylation. Additionally, the mechanism underlying the increased 5-HT secretion also requires further experimental research.

Article Snippet: Gene sequence ACTB-F GAGACCGCGTCCGCC ACTB-R ATCATCCATGGTGAGCTGGC TPH1-F CCCTTTGATCCCAAGATTAC TPH1-R CATTCATGGCACTGGTTATG PIEZO1-F ATCGCCATCATCTGGTTCCC PIEZO1-R TGGTGAACAGCGGCTCATAG PIEZO2-F TGGACACCATTGACGAGCAT PIEZO2-R CTTCAGTGTAGCAGCTGGAGAT PKCA-F GTCCACAAGAGGTGCCATGAA PKCA-R AAGGTGGGGCTTCCGTAAGT IP3R-F GCGGAGGGATCGACAAATGG IP3R-R TGGGACATAGCTTAAAGAGGCA MAPK-F TACACCAACCTCTCGTACATCG MAPK-R CATGTCTGAAGCGCAGTAAGATT AMPK-F TTGAAACCTGAAAATGTCCTGCT AMPK-R GGTGAGCCACAACTTGTTCTT frontiersin.org antibody: TPH1 (T0678, 1:200; Merck), Piezo1 (NBP1-78537, 1:200; Novus), Piezo2 (NBP1-78624, 1:200; Novus).

Techniques: Expressing, Phospho-proteomics

Fig. 1. Role of PIEZO1 and PIEZO2 in primary porcine chondrocytes during mechanical or pharmacologic activation. (A) Immunohistochemistry staining for PIEZO1 (red), PIEZO2 (yellow), and DAPI (blue). (Scale bar: 5 µm.) (B) mRNA levels of PIEZO1 (P1) and PIEZO2 (P2) normalized to ACTB expression level in nontargeting control (NTC) and P1-siRNA or P2-siRNA. (C) Protein levels of PIEZO1 (Left) and PIEZO2 (Right) in NTC and P1-siRNA or P2-siRNA chondrocytes. (D) AFM loading response of P1-siRNA cells compared to their respective NTCs showing representative cell signaling trend, normalized intracellular Ca2+ fluorescence intensity ΔFmax/F, the percentage of the responding cells, and deformation. (E) Confocal imaging results of Yoda1 stimulation of P1-siRNA cells compared to their respective NTCs showing representative cell signaling trend, normalized intracellular Ca2+ fluorescence intensity ΔFmax/F, and the percentage of responding cells. Similarly, results for P2-siRNA cells (F) AFM loading and (G) confocal imaging. Data presented as mean ± SEM. For B, n = 8 samples; for D and F, percentage of responders, n = 4 to 5 test batches, for applied deformation and Ca2+ response to AFM mechanical loading, n = 73 to 96 cells; For E and G, n = 9 to 21 tested wells; for group comparison B, D–G, t test, *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001.

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Membrane stretch as the mechanism of activation of PIEZO1 ion channels in chondrocytes.

doi: 10.1073/pnas.2221958120

Figure Lengend Snippet: Fig. 1. Role of PIEZO1 and PIEZO2 in primary porcine chondrocytes during mechanical or pharmacologic activation. (A) Immunohistochemistry staining for PIEZO1 (red), PIEZO2 (yellow), and DAPI (blue). (Scale bar: 5 µm.) (B) mRNA levels of PIEZO1 (P1) and PIEZO2 (P2) normalized to ACTB expression level in nontargeting control (NTC) and P1-siRNA or P2-siRNA. (C) Protein levels of PIEZO1 (Left) and PIEZO2 (Right) in NTC and P1-siRNA or P2-siRNA chondrocytes. (D) AFM loading response of P1-siRNA cells compared to their respective NTCs showing representative cell signaling trend, normalized intracellular Ca2+ fluorescence intensity ΔFmax/F, the percentage of the responding cells, and deformation. (E) Confocal imaging results of Yoda1 stimulation of P1-siRNA cells compared to their respective NTCs showing representative cell signaling trend, normalized intracellular Ca2+ fluorescence intensity ΔFmax/F, and the percentage of responding cells. Similarly, results for P2-siRNA cells (F) AFM loading and (G) confocal imaging. Data presented as mean ± SEM. For B, n = 8 samples; for D and F, percentage of responders, n = 4 to 5 test batches, for applied deformation and Ca2+ response to AFM mechanical loading, n = 73 to 96 cells; For E and G, n = 9 to 21 tested wells; for group comparison B, D–G, t test, *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001.

Article Snippet: Last, samples were labeled with conjugated rabbit PIEZO1 and PIEZO2 antibodies overnight (1:25, Novus Biologicals).

Techniques: Activation Assay, Immunohistochemistry, Staining, Expressing, Control, Fluorescence, Imaging, Comparison

Fig. 6. Schematic of the mechanism involved in PIEZO1 activation in response to membrane tension. As the cell is deformed and experiences tensile strains in the peripheral regions, the cell plasma membrane initially experiences unfolding. After the ruffles are unfolded, then the plasma membrane will experience local tensile strains. However, swelling of the cell with (A) hypoosmotic stress unfolds the ruffles prior to loading and exposes more PIEZO channels to the extracellular cues before mechanical compression, resulting in higher levels of intracellular Ca2+ signaling in the chondrocytes in response to mechanical compression compared to the (B) isoosmotically treated group. (C) On the other hand, applying a hyperosmotic stress decreases the cell size and increases membrane ruffling. Therefore, more deformation is required to unfold the membrane curvatures before inducing stretch of the plasma membrane. Consequently, the force and deformation necessary to unfold the membrane curvatures increase compared to the isoosmotically treated group. This change results in a smaller portion of the force being dedicated to compressing the cell and decreases the sensitivity of the PIEZO channel to mechanical compression.

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Membrane stretch as the mechanism of activation of PIEZO1 ion channels in chondrocytes.

doi: 10.1073/pnas.2221958120

Figure Lengend Snippet: Fig. 6. Schematic of the mechanism involved in PIEZO1 activation in response to membrane tension. As the cell is deformed and experiences tensile strains in the peripheral regions, the cell plasma membrane initially experiences unfolding. After the ruffles are unfolded, then the plasma membrane will experience local tensile strains. However, swelling of the cell with (A) hypoosmotic stress unfolds the ruffles prior to loading and exposes more PIEZO channels to the extracellular cues before mechanical compression, resulting in higher levels of intracellular Ca2+ signaling in the chondrocytes in response to mechanical compression compared to the (B) isoosmotically treated group. (C) On the other hand, applying a hyperosmotic stress decreases the cell size and increases membrane ruffling. Therefore, more deformation is required to unfold the membrane curvatures before inducing stretch of the plasma membrane. Consequently, the force and deformation necessary to unfold the membrane curvatures increase compared to the isoosmotically treated group. This change results in a smaller portion of the force being dedicated to compressing the cell and decreases the sensitivity of the PIEZO channel to mechanical compression.

Article Snippet: Last, samples were labeled with conjugated rabbit PIEZO1 and PIEZO2 antibodies overnight (1:25, Novus Biologicals).

Techniques: Activation Assay, Membrane, Clinical Proteomics

Fig. 5. Ca2+ signaling of chondrocytes in response to different mechanical loading rates in the presence of PIEZO1 nonspecific inhibitor GsMTx-4 and Ca2+ inhibitors thapsigargin and EGTA. (A) Applied deformation (%). (B) Intracellular Ca2+ fluorescence intensity ΔFmax/F, with Inset showing representative signaling trends. (C) Percentage of responding cells. Data presented as mean ± SEM. For group comparison A and B, one-way ANOVA with Tukey’s post hoc test, different letters indicate statistical significance P < 0.05 with no significance found in A, n = 12 to 42 cells.

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Membrane stretch as the mechanism of activation of PIEZO1 ion channels in chondrocytes.

doi: 10.1073/pnas.2221958120

Figure Lengend Snippet: Fig. 5. Ca2+ signaling of chondrocytes in response to different mechanical loading rates in the presence of PIEZO1 nonspecific inhibitor GsMTx-4 and Ca2+ inhibitors thapsigargin and EGTA. (A) Applied deformation (%). (B) Intracellular Ca2+ fluorescence intensity ΔFmax/F, with Inset showing representative signaling trends. (C) Percentage of responding cells. Data presented as mean ± SEM. For group comparison A and B, one-way ANOVA with Tukey’s post hoc test, different letters indicate statistical significance P < 0.05 with no significance found in A, n = 12 to 42 cells.

Article Snippet: Last, samples were labeled with conjugated rabbit PIEZO1 and PIEZO2 antibodies overnight (1:25, Novus Biologicals).

Techniques: Fluorescence, Comparison

Instability of Piezo1 loss-of-function mutants correlates with increased ubiquitination. (A) Piezo1 −/− HEK293T cells overexpressing wild-type (WT) or mutant Piezo1-GFP were treated with 10 μg/ml cycloheximide (CHX) for 0, 4 or 8 h before being collected for western blotting. (B) Summary data of panel (A) showing Piezo1 protein levels normalized to α-Actinin. (* p = 0.0320 and * p = 0.0133 for S217L at 4 and 8 h; * p = 0.0180 and * p = 0.0168 for G2029R at 4 and 8 h) (C) WT or mutant Piezo1-GFP expressed in Piezo1 −/− HEK293T cells were immunoprecipitated using an anti-GFP antibody and the eluted fraction and input cell lysate were probed for Piezo1 levels. An immunoblot of the immunoprecipitated protein using a mono- and poly-ubiquitin (Ub) antibody is also shown (M = marker). (D) Summary data of panel C showing the level of Piezo1 ubiquitination normalized to the level of immunoprecipitated Piezo1 protein ( n = 4 for all experiments). One way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis.

Journal: Frontiers in Pharmacology

Article Title: Loss-of-Function Piezo1 Mutations Display Altered Stability Driven by Ubiquitination and Proteasomal Degradation

doi: 10.3389/fphar.2021.766416

Figure Lengend Snippet: Instability of Piezo1 loss-of-function mutants correlates with increased ubiquitination. (A) Piezo1 −/− HEK293T cells overexpressing wild-type (WT) or mutant Piezo1-GFP were treated with 10 μg/ml cycloheximide (CHX) for 0, 4 or 8 h before being collected for western blotting. (B) Summary data of panel (A) showing Piezo1 protein levels normalized to α-Actinin. (* p = 0.0320 and * p = 0.0133 for S217L at 4 and 8 h; * p = 0.0180 and * p = 0.0168 for G2029R at 4 and 8 h) (C) WT or mutant Piezo1-GFP expressed in Piezo1 −/− HEK293T cells were immunoprecipitated using an anti-GFP antibody and the eluted fraction and input cell lysate were probed for Piezo1 levels. An immunoblot of the immunoprecipitated protein using a mono- and poly-ubiquitin (Ub) antibody is also shown (M = marker). (D) Summary data of panel C showing the level of Piezo1 ubiquitination normalized to the level of immunoprecipitated Piezo1 protein ( n = 4 for all experiments). One way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis.

Article Snippet: Identical protein amounts from input and biotinylated samples were loaded for western blotting then probed with; mouse monoclonal anti-Piezo1 antibody (Cat. No. NBP2-75617, Novus Biologicals), rabbit anti-GAPDH (CellSignaling) and mouse anti-Na + /K + ATPase antibody (a6F, DSHB).

Techniques: Ubiquitin Proteomics, Mutagenesis, Western Blot, Immunoprecipitation, Marker, Comparison

S217L and G2029R Piezo1 mutants go through proteasomal degradation. Piezo1 −/− HEK293T cells overexpressing WT or mutant Piezo1 were treated with (A) a lysosomal degradation inhibitor NH 4 Cl or (B) a proteasomal degradation inhibitor ALLN for 0, 9 or 24 h. Representative results are shown in the upper panel. Lower panel, summary data of the corresponding experiments with comparison between mutant and WT Piezo1 shown in blue for G2029R and in red for S217L. (C) Piezo1 −/− HEK293T cells overexpressing G2029R Piezo1 were treated with 0, 1 or 10 nM of Bortezomib for 24 h before being collected for western blot. Upper panel, representative western blot. Lower panel, summary data of the western blot experiments. One way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis (ns = not significant).

Journal: Frontiers in Pharmacology

Article Title: Loss-of-Function Piezo1 Mutations Display Altered Stability Driven by Ubiquitination and Proteasomal Degradation

doi: 10.3389/fphar.2021.766416

Figure Lengend Snippet: S217L and G2029R Piezo1 mutants go through proteasomal degradation. Piezo1 −/− HEK293T cells overexpressing WT or mutant Piezo1 were treated with (A) a lysosomal degradation inhibitor NH 4 Cl or (B) a proteasomal degradation inhibitor ALLN for 0, 9 or 24 h. Representative results are shown in the upper panel. Lower panel, summary data of the corresponding experiments with comparison between mutant and WT Piezo1 shown in blue for G2029R and in red for S217L. (C) Piezo1 −/− HEK293T cells overexpressing G2029R Piezo1 were treated with 0, 1 or 10 nM of Bortezomib for 24 h before being collected for western blot. Upper panel, representative western blot. Lower panel, summary data of the western blot experiments. One way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis (ns = not significant).

Article Snippet: Identical protein amounts from input and biotinylated samples were loaded for western blotting then probed with; mouse monoclonal anti-Piezo1 antibody (Cat. No. NBP2-75617, Novus Biologicals), rabbit anti-GAPDH (CellSignaling) and mouse anti-Na + /K + ATPase antibody (a6F, DSHB).

Techniques: Mutagenesis, Comparison, Western Blot

S217L and G2029R are trafficking-deficient mutants. (A) Western blot showing the membrane localized fraction of WT and mutant Piezo1 proteins Piezo1 from Piezo1 −/− HEK293T cells using a standard biotinylation assay. The membrane fraction of the eluted lysate is visualised using the ubiquitous membrane protein Na + /K + ATPase and the cytosolic protein GAPDH is shown as a comparison for whole protein lysate (Input) and bead elution (Membrane Fraction). (B) Summary data of panel (A) . One way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis. (C) HeLa cells overexpressing WT or mutant Piezo1 with GFP tag were stained with ER tracker and analysed using confocal microscopy. Notice that the WT Piezo1 is localized to the plasma membrane while the mutant Piezo1 co-localizes almost exclusively with the ER tracker. Scale bar, 10 µm. (D) Summary data showing the overlap of GFP (Piezo1) and the ER signal indicated by Pearson’s R value. One way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis.

Journal: Frontiers in Pharmacology

Article Title: Loss-of-Function Piezo1 Mutations Display Altered Stability Driven by Ubiquitination and Proteasomal Degradation

doi: 10.3389/fphar.2021.766416

Figure Lengend Snippet: S217L and G2029R are trafficking-deficient mutants. (A) Western blot showing the membrane localized fraction of WT and mutant Piezo1 proteins Piezo1 from Piezo1 −/− HEK293T cells using a standard biotinylation assay. The membrane fraction of the eluted lysate is visualised using the ubiquitous membrane protein Na + /K + ATPase and the cytosolic protein GAPDH is shown as a comparison for whole protein lysate (Input) and bead elution (Membrane Fraction). (B) Summary data of panel (A) . One way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis. (C) HeLa cells overexpressing WT or mutant Piezo1 with GFP tag were stained with ER tracker and analysed using confocal microscopy. Notice that the WT Piezo1 is localized to the plasma membrane while the mutant Piezo1 co-localizes almost exclusively with the ER tracker. Scale bar, 10 µm. (D) Summary data showing the overlap of GFP (Piezo1) and the ER signal indicated by Pearson’s R value. One way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis.

Article Snippet: Identical protein amounts from input and biotinylated samples were loaded for western blotting then probed with; mouse monoclonal anti-Piezo1 antibody (Cat. No. NBP2-75617, Novus Biologicals), rabbit anti-GAPDH (CellSignaling) and mouse anti-Na + /K + ATPase antibody (a6F, DSHB).

Techniques: Western Blot, Membrane, Mutagenesis, Cell Surface Biotinylation Assay, Comparison, Staining, Confocal Microscopy, Clinical Proteomics

ALLN partially rescues the membrane-localization of G2029R. (A) Piezo1 −/− HEK293T cells overexpressing WT or Piezo1-897HA were subjected to cell-attached patch clamping. Representative traces in response to square wave negative pressure pulses are shown. The right panel shows the summary data of peak currents elicited from cell-attached patches as a box and whiskers plot illustrating the minimum and maximum. (B) Schematic showing how the membrane intensity is calculated. A straight line was drawn across the GFP positive cells with only the GFP channel visible to preclude bias. The peak value of the HA signal within the membrane region, determined by GFP channel and bright field, was determined using Image J ’s Plot Profile tool. Peak values on each side of the cell were averaged as one data point. (C–E) Piezo1 −/− HEK293T cells overexpressing WT or mutant Piezo1 with an extracellular 897-HA tag were stained with anti-HA antibody and Alexa-555 goat anti mouse secondary antibody before PFA fixation. All figures were taken under the same optical configuration and presented with the same maximum/minimum intensity. Red channel, signal from HA antibody; green channel, signal from free GFP. Scale bar, 10 µm. (F) Summary data from Panels (C–E) . Y axis represents membrane intensity in arbitrary fluorescent units. Comparison between treated and untreated cells was caried out using Student’s t-test.

Journal: Frontiers in Pharmacology

Article Title: Loss-of-Function Piezo1 Mutations Display Altered Stability Driven by Ubiquitination and Proteasomal Degradation

doi: 10.3389/fphar.2021.766416

Figure Lengend Snippet: ALLN partially rescues the membrane-localization of G2029R. (A) Piezo1 −/− HEK293T cells overexpressing WT or Piezo1-897HA were subjected to cell-attached patch clamping. Representative traces in response to square wave negative pressure pulses are shown. The right panel shows the summary data of peak currents elicited from cell-attached patches as a box and whiskers plot illustrating the minimum and maximum. (B) Schematic showing how the membrane intensity is calculated. A straight line was drawn across the GFP positive cells with only the GFP channel visible to preclude bias. The peak value of the HA signal within the membrane region, determined by GFP channel and bright field, was determined using Image J ’s Plot Profile tool. Peak values on each side of the cell were averaged as one data point. (C–E) Piezo1 −/− HEK293T cells overexpressing WT or mutant Piezo1 with an extracellular 897-HA tag were stained with anti-HA antibody and Alexa-555 goat anti mouse secondary antibody before PFA fixation. All figures were taken under the same optical configuration and presented with the same maximum/minimum intensity. Red channel, signal from HA antibody; green channel, signal from free GFP. Scale bar, 10 µm. (F) Summary data from Panels (C–E) . Y axis represents membrane intensity in arbitrary fluorescent units. Comparison between treated and untreated cells was caried out using Student’s t-test.

Article Snippet: Identical protein amounts from input and biotinylated samples were loaded for western blotting then probed with; mouse monoclonal anti-Piezo1 antibody (Cat. No. NBP2-75617, Novus Biologicals), rabbit anti-GAPDH (CellSignaling) and mouse anti-Na + /K + ATPase antibody (a6F, DSHB).

Techniques: Membrane, Mutagenesis, Staining, Comparison

Mechanically-evoked G2029R currents are increased by ALLN treatment. (A) Piezo1 −/− HEK293T cells overexpressing WT or mutant Piezo1 were treated with or without ALLN for 10–15 h before cell-attached patch clamping. Representative traces are shown. (B) Summary data from panel (A) illustrating the peak currents elicited from cell-attached patches from Piezo1 −/− HEK293T cells overexpressing WT or mutant Piezo1 with or without ALLN treatment. p values determined using Student’s t-test to compare treated and untreated cells.

Journal: Frontiers in Pharmacology

Article Title: Loss-of-Function Piezo1 Mutations Display Altered Stability Driven by Ubiquitination and Proteasomal Degradation

doi: 10.3389/fphar.2021.766416

Figure Lengend Snippet: Mechanically-evoked G2029R currents are increased by ALLN treatment. (A) Piezo1 −/− HEK293T cells overexpressing WT or mutant Piezo1 were treated with or without ALLN for 10–15 h before cell-attached patch clamping. Representative traces are shown. (B) Summary data from panel (A) illustrating the peak currents elicited from cell-attached patches from Piezo1 −/− HEK293T cells overexpressing WT or mutant Piezo1 with or without ALLN treatment. p values determined using Student’s t-test to compare treated and untreated cells.

Article Snippet: Identical protein amounts from input and biotinylated samples were loaded for western blotting then probed with; mouse monoclonal anti-Piezo1 antibody (Cat. No. NBP2-75617, Novus Biologicals), rabbit anti-GAPDH (CellSignaling) and mouse anti-Na + /K + ATPase antibody (a6F, DSHB).

Techniques: Mutagenesis

Schematic figure illustrating the trafficking pathway for WT, S217L and G2029R with or without ALLN. WT Piezo1 transits from ER to plasma membrane and is finally degraded through membrane-protein internalization and lysosome dependent degradation. Unlike the WT Piezo1, both S217L and G2029R Piezo1 go through ubiquitination and proteasome dependent degradation. Treatment with the proteasomal inhibitor ALLN did not influence the membrane localization of S217L, while G2029R was partially rescued exhibiting increased membrane labelling and increased amplitudes of mechanically-evoked currents. Black arrow indicates the trafficking pathway for all Piezo1 proteins without ALLN treatment; red arrow indicates the trafficking pathway for S217L and G2029R Piezo1 after ALLN treatment (Ub-ubiquitin, P/I-proteasomal inhibition).

Journal: Frontiers in Pharmacology

Article Title: Loss-of-Function Piezo1 Mutations Display Altered Stability Driven by Ubiquitination and Proteasomal Degradation

doi: 10.3389/fphar.2021.766416

Figure Lengend Snippet: Schematic figure illustrating the trafficking pathway for WT, S217L and G2029R with or without ALLN. WT Piezo1 transits from ER to plasma membrane and is finally degraded through membrane-protein internalization and lysosome dependent degradation. Unlike the WT Piezo1, both S217L and G2029R Piezo1 go through ubiquitination and proteasome dependent degradation. Treatment with the proteasomal inhibitor ALLN did not influence the membrane localization of S217L, while G2029R was partially rescued exhibiting increased membrane labelling and increased amplitudes of mechanically-evoked currents. Black arrow indicates the trafficking pathway for all Piezo1 proteins without ALLN treatment; red arrow indicates the trafficking pathway for S217L and G2029R Piezo1 after ALLN treatment (Ub-ubiquitin, P/I-proteasomal inhibition).

Article Snippet: Identical protein amounts from input and biotinylated samples were loaded for western blotting then probed with; mouse monoclonal anti-Piezo1 antibody (Cat. No. NBP2-75617, Novus Biologicals), rabbit anti-GAPDH (CellSignaling) and mouse anti-Na + /K + ATPase antibody (a6F, DSHB).

Techniques: Clinical Proteomics, Membrane, Ubiquitin Proteomics, Inhibition

Journal: Cell Reports Medicine

Article Title: Injectable hydrogel with miR-222-engineered extracellular vesicles ameliorates myocardial ischemic reperfusion injury via mechanotransduction

doi: 10.1016/j.xcrm.2025.101987

Figure Lengend Snippet:

Article Snippet: FAM38A/PIEZO1 Rabbit mAb , ABclonal , Cat #A23380, RRID: AB_3095404.

Techniques: Produced, Recombinant, Western Blot, Lysis, Bicinchoninic Acid Protein Assay, Staining, TUNEL Assay, CCK-8 Assay, cDNA Synthesis, Sequencing, Software